Megaman EXE RPG |
Administrators: {{J.G.}} {{Agent Q}} Global Moderators: {{Kirote.EXE}} {{Queen Sludge}} {{ Plot Moderators: None...Yet |
Stardate 20xx |
{{Megaman EXE RPG Rules}} {{Megaman EXE RPG News}} {{Megaman EXE Plot Summary}} {{BattleChip List}} {{Character Template}} {{Character Development Sandcastle}} {{Active Topics List}} {{Active Members List}} |
| We hope you enjoy your visit. You're currently viewing our forum as a guest. This means you are limited to certain areas of the board and there are some features you can't use. If you join our community, you'll be able to access member-only sections, and use many member-only features such as customizing your profile, sending personal messages, and voting in polls. Registration is simple, fast, and completely free. Join our community! Please note that after registering, you are required to validate by email as well as be validated by an administrator. If this process takes more than one day, please notify a staff member in the board Cbox. If you're already a member please log in to your account to access all of our features: |
| Thughts that make your brain hurt | |
|---|---|
| Tweet Topic Started: Apr 5 2007, 09:16 PM (387 Views) | |
| Pancake Mix | Apr 7 2007, 02:45 PM Post #21 |
![]()
BLARGAHGRHGARR
![]()
|
For the hell of it: Tooth1: Hah! I claim this mouth in the name of Incisor! Tooth2: Not so fast! Tooth1: *gasp* Bicuspid! Teeth:*try to fight, struggle* Tooth1: Well, it seems we cannot move. Tooth2: SHall we bite the tongue? Tooth1: On 3. One, two.. Stewy: GAH!*clutches mouth* |
![]() |
|
| Blazewind | Apr 7 2007, 02:53 PM Post #22 |
![]()
Bored of life. Or life got bored of me. Meh.
![]()
|
Imagine a flat Sphere and a One Sided Pancake. |
![]() |
|
| Pancake Mix | Apr 7 2007, 05:10 PM Post #23 |
![]()
BLARGAHGRHGARR
![]()
|
Capitalizing the word "pancake" has gotten to be a habit, eh? Mwahaha...my sinister grip extends into even grammar! Try to think of an eleven-sided perfect object(no uneven sides) that exist on the edges of Triangles. These actually exist in 3D, while the triangle exists in 2D. Quantum Mathematics at it's best. |
![]() |
|
| Anime Master ZERO | Apr 7 2007, 05:29 PM Post #24 |
|
Net Savior
![]()
|
If you guys want thoughts that make brains hurt on a serious note, then I've got a few. They all have to do with existence. |
![]() |
|
| J.G. | Apr 7 2007, 05:30 PM Post #25 |
![]()
abba-zabba, you my only friend
![]()
|
Like I said, nothing beats Time Travel for hours of migraine fun. For me at least. |
![]() |
|
| Anime Master ZERO | Apr 7 2007, 05:35 PM Post #26 |
|
Net Savior
![]()
|
Then try asking yourself these questions and answering them. Why do I exist? How am I able to exist? And that's just for starters. |
![]() |
|
| J.G. | Apr 7 2007, 05:39 PM Post #27 |
![]()
abba-zabba, you my only friend
![]()
|
Oh, boy. This topic is about to become another discussion about religion (or lack thereof). From the Christian perspetive, first. 1. We exist because God, in His infinite kindness, decided to make us in his own image. 2. See above. But to play Devil's Advocate (no pun intended), 1. Because our ancestors, by the law of evolution, were the most fit to survive, and eventually they, through many genetic mutations, became us. As for purpose, our only purpose is to procreate. 2. See above. |
![]() |
|
| Deleted User | Apr 7 2007, 05:43 PM Post #28 |
|
Deleted User
|
1. Because God decided he wanted to make earth, which he then made people. 2.Because in the above he made you with a will. |
|
|
| Anime Master ZERO | Apr 7 2007, 06:00 PM Post #29 |
|
Net Savior
![]()
|
That is true, but for what purpose do we have to exist? And in all of the great universe, why do we exist here? And why in the bodies that we have? We could have just as easily been brought into this life on another world or even in another form. Also, these questions have NOTHING to do with religion. |
![]() |
|
| Pat the Bunny | Apr 7 2007, 06:04 PM Post #30 |
|
The Rapid-mating Bunny!
![]()
|
AMZ, I have ONE thing to say to you 42 |
![]() |
|
| Anime Master ZERO | Apr 7 2007, 06:05 PM Post #31 |
|
Net Savior
![]()
|
What? |
![]() |
|
| J.G. | Apr 7 2007, 06:08 PM Post #32 |
![]()
abba-zabba, you my only friend
![]()
|
Well, once more, from the Christian perspective, we are put on earth to live our lives for God. We exist here because God choose to put us here, and we are made in the image of God. And from the DA perspective, we exist only to further the species. We have no personal purpose, only the fruitless goal of furthuring our own species. The rest is chance. EDIT: 42, according to Douglas Adams's "The Hitchhiker's Guide to the Galaxy", is the answer to the ultimate question of life, the universe, and everything. |
![]() |
|
| Pancake Mix | Apr 7 2007, 06:24 PM Post #33 |
![]()
BLARGAHGRHGARR
![]()
|
Q: Why do I exist? A: There IS no purpose to existing. Why do we seek an answer that does not exist? It's comfortable to think there's a higher reason for things, that way, we don't have to worry. Same reason why there's religion. (Christians, you may fire at will) Q:How am I able to exist? A: Is non-existance more frequent then existance? With an infinite amount of time, SOMETHING would arise. Take one of the arguments against Evolution. Supposedly, things like say, an eye, are too complicated to have arisen ranodmly. Well, it's been proven that, with the conditions of early Earth, that little individual proteins form, however, no life does. Well, I can't just type "GTCAGTGCATGCATGCATCGATGCATGCACATGCTAGTCTAGC" and expect that to be half of a gene right there. However, it's NOT hard to imagine that, given a period of time and random interaction, that eventually, proteins capable of duplicating themselves could arise. These would multiply, and eventually overtake the random ones. Then, one of them could mutate, and gain an advantage in some way, say, they can develop a barrier around themselves out of other proteins. That would protect them from the environmental hazards of the time, and give them an edge, thus, they multiply more then other proteins. And so on. Frankly, I don't see why people can't accept a compromise like say, some higher power set the laws of physics and evolution in motion. Here's a good "Duuuuuude, ya ever wonder...?" question: Why do Human beings have an inherent "destroy" instinct? Watch a little kid at the beach sometime, they'll knock over whatever sand castles otehr kids may have made for sure. Or better yet: Why do we bother asking such questions? |
![]() |
|
| Deleted User | Apr 7 2007, 06:36 PM Post #34 |
|
Deleted User
|
Because...(from christian perspective): We have sin in our life. DA (sorry for stealing):Because throught the ages man has adapted to be the strongest and as such deings to be the cruelest in order to hold on to that superiority. I just don't see how a sun could randomly form at the right place so we wouldn't fry nor freeze. same with pretty much everything else. |
|
|
| Pancake Mix | Apr 7 2007, 06:45 PM Post #35 |
![]()
BLARGAHGRHGARR
![]()
|
It's logic. The sun formed before Earth, had the EARTH formed some where else, there wouldn't be life on it. Simple as that. |
![]() |
|
| Deleted User | Apr 7 2007, 06:56 PM Post #36 |
|
Deleted User
|
right....but think of all the other stuff. Like the moon, the atmosphere, plants, mountains.... |
|
|
| Pancake Mix | Apr 7 2007, 07:07 PM Post #37 |
![]()
BLARGAHGRHGARR
![]()
|
*blanches* Can you think outside of what the church teaches you? The moon was formed when the proto-Earth was hit by a meteor, and a lot of it's mass ejected into space. This eventually condensed into the Moon. The atmosphere is a result of, believe it or not, waste! In the beggining of our planet, bacteria "inhaled" the current atmosphere, and "exhaled" our current one. This is a simplified explanation. The mountains are the result of tectonic plate movement. Sorry about the rude, but people who blindly believe in things, without thinking for themselves, make me angry inside. Let me quote Philospher Bertrand russel: "If I were to suggest that between the Earth and Mars there is a china teapot revolving about the sun in an elliptical orbit, nobody would be able to disprove my assertion provided I were careful to add that the teapot is too small to be revealed even by our most powerful telescopes. But if I were to go on to say that, since my assertion cannot be disproved, it is intolerable presumption on the part of human reason to doubt it, I should rightly be thought to be talking nonsense. If, however, the existence of such a teapot were affirmed in ancient books, taught as the sacred truth every Sunday, and instilled into the minds of children at school, hesitation to believe in its existence would become a mark of eccentricity and entitle the doubter to the attentions of the psychiatrist in an enlightened age or of the Inquisitor in an earlier time." |
![]() |
|
| Deleted User | Apr 7 2007, 07:14 PM Post #38 |
|
Deleted User
|
hmmm, I don't learn this all in chirch you know. How do you know personally that there was an asteroid that crashed into earth? |
|
|
| Pancake Mix | Apr 7 2007, 07:16 PM Post #39 |
![]()
BLARGAHGRHGARR
![]()
|
Evidence of an impact are found in very old rocks(or Ice, but not in this case), which have an inner layer of Iridium, a common metal in asteroids, but nearly never naturally occuring on earth. Scientists know how fast rock accumulates in some areas, so they can trace the occurance of the impact to when it happened. |
![]() |
|
| Deleted User | Apr 7 2007, 07:54 PM Post #40 |
|
Deleted User
|
all you stated in your last post said that asteroids hit earth.It didn't prove that the moon was made of part earth and part asteroid. |
|
|
| 1 user reading this topic (1 Guest and 0 Anonymous) | |
| Go to Next Page | |
| « Previous Topic · General Discussion · Next Topic » |












9:14 AM Jul 11